Laboratory techniques - PDFSEARCH.IO - Document Search Engine

Laboratory techniques
Results: 7358

#	Item
811	Sponsored document from Journal of Feline Medicine and Surgery Published as: J Feline Med SurgApril ; 10(2-3): 167–174. Add to Reading List Source URL: www.2ndchance.info Language: English - Date: 2014-02-04 17:38:13 Chemistry Polymerase chain reaction Laboratory techniques Animal virology Viruses Feline coronavirus Viral load Reverse transcription polymerase chain reaction Reverse transcriptase Biology Molecular biology Biochemistry
812	Int. J. BiosciInternational Journal of Biosciences (IJB) ISSN: PrintOnline) Add to Reading List Source URL: www.innspub.net Language: English - Date: 2012-02-22 10:02:39 Molecular biology Enzymes Electrophoresis Laboratory techniques Cellulose Cellulase Xylanase SDS-PAGE Termite Chemistry Biology Biochemistry
813	category primer sequence SSLP markers zC250L3F GGGTTTGTGAATGGAATGATG zC250L3R AGCGTCCACTGCTCAGAATC zC74M13F CCTCCTCCCAAAAACACATC Add to Reading List Source URL: jhoonline.org Language: English Chemistry Polymerase chain reaction Laboratory techniques DNA methyltransferase Biotechnology DNMT1 Real-time polymerase chain reaction Primer Biology Molecular biology Biochemistry
814	The Brain Opera Technology: New Instruments and Gestural Sensors for Musical Interaction and Performance Joseph A. Paradiso MIT Media Laboratory E15-325 Cambridge MAUSA Add to Reading List Source URL: www.cba.mit.edu Language: English - Date: 2011-12-13 18:32:02 Electronic musical instruments User interface techniques Keyboard instruments Game controllers MIDI Tod Machover Touchscreen Capacitive sensing Touchpad Humanâ€“computer interaction Computer hardware Music
815	doi:S0304 Add to Reading List Source URL: depts.washington.edu Language: English - Date: 2004-02-26 11:25:41 Peptide mass fingerprinting Matrix-assisted laser desorption/ionization Time-of-flight mass spectrometry Peptide Bovine serum albumin Proteolysis Sinapinic acid Protein mass spectrometry Sample preparation in mass spectrometry Chemistry Laboratory techniques Mass spectrometry
816	CHEMCAD 5 Version 5.0 Book of Examples Part1: Steady-State Simulation Release Add to Reading List Source URL: www.chemstations.com Language: English - Date: 2009-04-17 14:52:24 Unit operations Oil refining Laboratory techniques Reboiler Hydrodesulfurization Naphtha Oil refinery Petroleum Batch distillation Chemistry Chemical engineering Distillation
817	JOURNAL OF PLANKTON RESEARCH j VOLUME Add to Reading List Source URL: www.ieo-gijon.es Language: English - Date: 2012-02-03 06:23:50 Scientific method Laboratory equipment Clinical pathology Flow cytometry Hemocytometer Particle-size distribution Microscopy Coulter counter Chemical imaging Chemistry Science Laboratory techniques
818	COMMUNICATIONS The mass analysis of virus particles is performed by using electrospray-ionization time-of-flight mass spectrometry with charge detection through the simultaneous measurement Add to Reading List Source URL: masspec.scripps.edu Language: English - Date: 2013-12-10 15:01:41 Mass spectrometry Ion source Mass analyzer Chemical pathology Electrospray ionization Mass spectrum Time-of-flight mass spectrometry Quadrupole mass analyzer Electrospray Chemistry Analytical chemistry Laboratory techniques
819	This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author’s institution, sharing with colleag Add to Reading List Source URL: faculty.washington.edu Language: English - Date: 2007-10-27 17:25:23 Science Mass spectrometry Isotope-ratio mass spectrometry Column chromatography High-performance liquid chromatography Gas chromatography Elution Hydrophilic interaction chromatography Isotopic labeling Chemistry Chromatography Laboratory techniques
820	Microbial DNA Sample Preparation Microbial Sequencing Program DNA Sample Submission Guidelines The JGI has sequenced over 3000 prokaryotic, eukaryotic and metagenomic projects and finished over 300 genomes. DNA quality Add to Reading List Source URL: 1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com Language: English - Date: 2014-04-03 15:30:40 Chemistry Genomics Laboratory techniques Polymerase chain reaction Bioinformatics Metagenomics Gel electrophoresis Genome DNA Biology Molecular biology Biochemistry

UPDATE